| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.056034 |
| Chromosome: | chromosome 11 |
| Location: | 663351 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467616 | Dyf-13,IFT56,Ttc26 | (1 of 3) PF12895 - Anaphase-promoting complex, cyclosome, subunit 3 (ANAPC3); Intraflagellar Transport Protein 56 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGAAAAACATCGGGTCCGGGTCCTCGTGCTGCAACAGCTCCTTGTAGAT |
| Internal bar code: | CGTCCCTGGTGGTGATATCAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 5810 |
| LEAP-Seq percent confirming: | 91.6667 |
| LEAP-Seq n confirming: | 11 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCATCTCTAGCCGTTACGCT |
| Suggested primer 2: | GGGGAGGTAGGTGGAGATGT |