Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.056035 |
Chromosome: | chromosome 3 |
Location: | 1688196 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g153150 | (1 of 1) IPR000719//IPR001245//IPR001849//IPR002290//IPR011009//IPR011993//IPR020635 - Protein kinase domain // Serine-threonine/tyrosine-protein kinase catalytic domain // Pleckstrin homology domain // Serine/threonine/dual specificity protein kinase, catalytic domain // Protein kinase-like domain // Pleckstrin-homology domain (PH domain)/Phosphotyrosine-binding domain (PTB) // Tyrosine-protein kinase, catalytic domain | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCACTCCGCCCCCATGCGCGAAGCACGCAGTCGCACTTGCGCATAAGCA |
Internal bar code: | GATATTCTCGGTTTCTTGTAAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2444 |
LEAP-Seq percent confirming: | 72.7273 |
LEAP-Seq n confirming: | 8 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CACGAACTGGGTGCTGGTAT |
Suggested primer 2: | TCGTATACGCCATGGTGTCG |