Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.056084 |
Chromosome: | chromosome 3 |
Location: | 3963492 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g171250 | (1 of 1) IPR000104//IPR011989//IPR012677//IPR013083 - Antifreeze protein, type I // Armadillo-like helical // Nucleotide-binding alpha-beta plait domain // Zinc finger, RING/FYVE/PHD-type | 5'UTR | |
Cre03.g171300 | GYX1 | (1 of 1) 1.1.3.15 - (S)-2-hydroxy-acid oxidase / Hydroxy-acid oxidase B; Glycolate oxidase | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTCCGTCTCGACTGGAGCTTGATATTTAGATAGATTGATGCAAATATGC |
Internal bar code: | TGTGATGCATATTCCTCTTTCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2146 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 15 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CACACAACGAAACAGGCCTG |
Suggested primer 2: | AGCACTGAAGGCTCACAGAC |