| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.056146 |
| Chromosome: | chromosome 10 |
| Location: | 942241 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g424400 | PBB1 | 20S proteasome beta subunit B, type beta 2; (1 of 1) K02739 - 20S proteasome subunit beta 2 (PSMB7) | 3'UTR |
| Cre10.g424450 | TOM40 | 40 kDa translocon at mitochondrial outer envelope membrane; (1 of 1) K11518 - mitochondrial import receptor subunit TOM40 (TOM40) | outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGCATGTTCGTCAGCAATGCCGCCTGGATCCAAGCACCCCACGCCGGCC |
| Internal bar code: | TGCAAAAAGATATGCAACTATA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3166 |
| LEAP-Seq percent confirming: | 78.6667 |
| LEAP-Seq n confirming: | 59 |
| LEAP-Seq n nonconfirming: | 16 |
| LEAP-Seq n unique pos: | 75 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTGGGGTTTGCATGTTTGG |
| Suggested primer 2: | GCGTGGAGGAAGTGTGAGAA |