Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.056161 |
Chromosome: | chromosome 4 |
Location: | 3637507 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre04.g228675 | (1 of 781) IPR000104 - Antifreeze protein, type I | intron | |
lncRNA_TCONS_00096852 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGTCCCTGGCCCGCCGTTCTGCTCGCGGTTGCACGCGCGCGACCCCATCT |
Internal bar code: | ATAGGTTTCGAAGAGTCGGTGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 160 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 2 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCAAGCAACAACTGGGAACG |
Suggested primer 2: | TGGTCCAACGCATGTTACGA |