| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.056165 |
| Chromosome: | chromosome 12 |
| Location: | 8120438 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g552300 | CTL3 | (1 of 1) IPR001304//IPR016187//IPR024616 - C-type lectin // C-type lectin fold // Pherophorin; Putative pherophorin with C-type lectin | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCAAGCCCAGCATGCCGTCCTCGTCATCGGCTTCTCCCGCTGCCCCTTT |
| Internal bar code: | AGAGTCAAGACCGGGGAGGCTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 55 |
| LEAP-Seq percent confirming: | 1.28205 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 77 |
| LEAP-Seq n unique pos: | 78 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGAAGCTACGCGCCTTATCT |
| Suggested primer 2: | TGGAGAAGGGGAGGGAGAAG |