Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.056239 |
Chromosome: | chromosome 6 |
Location: | 6727214 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g295400 | MITC11,MCP11 | Mitochondrial substrate carrier protein; (1 of 1) PTHR24089//PTHR24089:SF223 - FAMILY NOT NAMED // MITOCHONDRIAL SUBSTRATE CARRIER FAMILY PROTEIN G | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCCCCCCCCCCCCGCGTGTGTGACGTCTTGTGTCATCCAACAGGCACGG |
Internal bar code: | GGAGGGGTAAAATATTCGAAAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 93 |
LEAP-Seq percent confirming: | 1.21951 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 81 |
LEAP-Seq n unique pos: | 82 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACACACACACACACACACCT |
Suggested primer 2: | GTTGCCGTTCCAGACTCTCA |