| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.056276 |
| Chromosome: | chromosome 12 |
| Location: | 6989488 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g560800 | (1 of 2) K14664 - IAA-amino acid hydrolase [EC:3.5.1.-] (ILR1) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGTTCGCTGTGCGAAGGAAGCCAACAGCGGGCATCCCCACCCGCCGGCC |
| Internal bar code: | GGTGGGAGCTCGTCATATGATT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3071 |
| LEAP-Seq percent confirming: | 94.7368 |
| LEAP-Seq n confirming: | 54 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 57 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTAACCACCACACCGGACA |
| Suggested primer 2: | CGGGTAGGTGTACGGTATGC |