| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.056278 |
| Chromosome: | chromosome 17 |
| Location: | 1228907 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g704950 | (1 of 2) PTHR13140//PTHR13140:SF410 - MYOSIN // SUBFAMILY NOT NAMED | 3'UTR | |
| Cre17.g705000 | FAP223,CDPK1 | (1 of 1) PF00069//PF00168//PF13499//PF13833 - Protein kinase domain (Pkinase) // C2 domain (C2) // EF-hand domain pair (EF-hand_7) // EF-hand domain pair (EF-hand_8); Flagellar Associated Protein 223 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGTCGGTTTGAGACGCAGTAAGAGCCGAACCAATGAATCTGCGTTGAGT |
| Internal bar code: | CTCATGTCTCGGAGCAGCGTAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2891 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 71 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 71 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGAGGGGCTATCAGAAGCT |
| Suggested primer 2: | GGTTGGGAGTTGGCTAGCAT |