Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.056290 |
Chromosome: | chromosome 16 |
Location: | 4434653 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g668200 | ING? | (1 of 1) PF00628//PF12998 - PHD-finger (PHD) // Inhibitor of growth proteins N-terminal histone-binding (ING); PHD-type zinc-finger protein | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGATGGAGTGGCAGGGCCGAGTGCTCGTACGCACTGCTGCTGCCCGCTG |
Internal bar code: | AACAGTTGAAAAAATTGAATCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 4093 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 57 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 57 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCCGTGCATGCATTCCTCTT |
Suggested primer 2: | CGCATGCTAACCGTTGTAGC |