| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.056337 |
| Chromosome: | chromosome 3 |
| Location: | 8585212 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g800406 | (1 of 21) IPR001584//IPR012337 - Integrase, catalytic core // Ribonuclease H-like domain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACACTTGCACGATGGGTAGCGGGTGCAGGGGCTGGTGTCGCACAAGCACG |
| Internal bar code: | CTCCTTCGAGCATCAGCATATT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2469 |
| LEAP-Seq percent confirming: | 1.2987 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 76 |
| LEAP-Seq n unique pos: | 77 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGCAGTACCGGAGTTTCGT |
| Suggested primer 2: | CCTTCTCCCTCTGAGTCCCA |