| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.056343 |
| Chromosome: | chromosome 14 |
| Location: | 144822 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g608452 | (1 of 1) K11366 - ubiquitin carboxyl-terminal hydrolase 22/27/51 [EC:3.4.19.12] (USP22_27_51, UBP8) | 5'UTR_intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCAAGTAGTCTGGAGTAGTAGTGGTGATAAGTAAGGCTCGTTGGTAAAG |
| Internal bar code: | AATGTTTTCATCCGAATTCCTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3030 |
| LEAP-Seq percent confirming: | 28.8136 |
| LEAP-Seq n confirming: | 17 |
| LEAP-Seq n nonconfirming: | 42 |
| LEAP-Seq n unique pos: | 59 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGTCCTCGAAGTCAGCCAA |
| Suggested primer 2: | TCATCCCCCAATGCTGGAAC |