Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.056354 |
Chromosome: | chromosome 16 |
Location: | 4548691 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g671350 | ARS2 | (1 of 2) IPR012083 - Arylsulfatase; Periplasmic arylsulfatase 2 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGTAAAGCAGTGGGTACATGCACGCACAATTGCGTCGGACAGAAGAGTA |
Internal bar code: | GGCTCAATTTTGGAATTGCGGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1857 |
LEAP-Seq percent confirming: | 52.1739 |
LEAP-Seq n confirming: | 12 |
LEAP-Seq n nonconfirming: | 11 |
LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGCCGTTAAGTGCATCCTGT |
Suggested primer 2: | TCCATGCCTAACACACACCC |