Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.056370 |
Chromosome: | chromosome 5 |
Location: | 394091 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre05.g243600 | GOX2 | Glyoxal or galactose oxidase pseudogene; (1 of 1) IPR013783//IPR014756//IPR015202 - Immunoglobulin-like fold // Immunoglobulin E-set // Domain of unknown function DUF1929 | 3'UTR |
Cre05.g243650 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCTCAAGCCAGCGTGCGTGCATGCCGCATTGTGCGCACACACCTGCAGA |
Internal bar code: | GAATACGCTATTTGGAGTTTCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2016 |
LEAP-Seq percent confirming: | 97.7528 |
LEAP-Seq n confirming: | 87 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 89 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCATCGCTCGCACATAGTCC |
Suggested primer 2: | GCAGTAGCAATGCTGGCATC |