Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | + |
Strain: | CLIP2.056401 |
Chromosome: | chromosome 10 |
Location: | 1352062 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g427700 | HEL47 | (1 of 1) PTHR24031:SF235 - DEAD-BOX ATP-DEPENDENT RNA HELICASE 37-RELATED; DEAD box ATP-dependent RNA helicase | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCATATCCACTTTCTTGCCCAACGCGGGCTATGCTTATCCCGCTCTGGC |
Internal bar code: | GCTGGAGTCGTTGTAAAGGTTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2923 |
LEAP-Seq percent confirming: | 98.9848 |
LEAP-Seq n confirming: | 195 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 197 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGTCTGAACGTAATGCTGCG |
Suggested primer 2: | CAACCGACAGCGCAAAAGAA |