| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.056458 |
| Chromosome: | chromosome 3 |
| Location: | 3321651 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g165900 | PGM17 | (1 of 3) 3.1.3.46 - Fructose-2,6-bisphosphate 2-phosphatase / Fructose-2,6-bisphosphatase; Putative phosphoglycerate mutase | outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCACCAGAGCGCTGCGTCAATAGGAAGTTGACACCAGAGAAGATGCGAGC |
| Internal bar code: | CTTTTTCTCTGTTATTCTGTTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 812 |
| LEAP-Seq percent confirming: | 65.2174 |
| LEAP-Seq n confirming: | 15 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGAAGCATGACGAAGGGACA |
| Suggested primer 2: | ACATCGCGGCGCATAAGATA |