Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | - |
Strain: | CLIP2.056463 |
Chromosome: | chromosome 16 |
Location: | 3909950 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g689250 | GTR23 | (1 of 1) PF04564//PF06701 - U-box domain (U-box) // Mib_herc2 (MIB_HERC2); Putative ubiquitin-protein ligase | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATGGCTGTTGCCAAAACGACGGGTATTCAGTGCGTAACACCGTGTTCAC |
Internal bar code: | ACGGGACCGTCAACATCATAGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 774 |
LEAP-Seq percent confirming: | 55.5556 |
LEAP-Seq n confirming: | 5 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTGAAGCTGGGGTGTTGCTA |
Suggested primer 2: | GGCTATACGGTCTTCCCACG |