| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.056482 |
| Chromosome: | chromosome 12 |
| Location: | 5645180 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g531600 | EIF5Bd | (1 of 1) K13690 - alpha-1,3-mannosyltransferase [EC:2.4.1.-] Man a1-3 Man (CMT1); putative translation initiation factor eIF-2 beta chain | 3'UTR |
| Cre12.g531651 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGGGCCTGGCGGCGACGTCCTCCGTCGTCCTCAAAGCGGCGGCCTCACA |
| Internal bar code: | CCGATGACACAGATATGAGCAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3278 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 39 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 39 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTTGGAGTTCGTGCGCAAA |
| Suggested primer 2: | AACCACCATCAGGCCAAGAG |