| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.056489 |
| Chromosome: | plastome |
| Location: | 127182 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreCp.g802316 | ChreCp052,2717043,ycf10,cemA | (1 of 1) PTHR33650:SF2 - CHLOROPLAST ENVELOPE MEMBRANE PROTEIN; heme-binding protein | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATAGATATTTCTCTGCGTGAGGAAAAACCATTAACGCTTGTACAAGGTGT |
| Internal bar code: | CTGCCACTGAGTGGTTACATTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 222 |
| LEAP-Seq percent confirming: | 40.0 |
| LEAP-Seq n confirming: | 2 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGTAGCTGGCGATGAACGA |
| Suggested primer 2: | TGCCCTATACCTACCGTGCA |