| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.056494 |
| Chromosome: | chromosome 1 |
| Location: | 128557 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g000950 | MFT13 | Major facilitator superfamily transporter; (1 of 3) PTHR23505:SF21 - SPHINGOLIPID TRANSPORTER SPINSTER HOMOLOG 1-RELATED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGGGCTGGGACGTGGGGTAGTGCTGGCAGAGGGGGCGTCGGGCAGAAGG |
| Internal bar code: | TGCTGTAGGTTGTGCTAATAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 143 |
| LEAP-Seq percent confirming: | 41.1765 |
| LEAP-Seq n confirming: | 7 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCTAGAGTGCAGGGTACGC |
| Suggested primer 2: | CCACACATACATACGCCCCA |