| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.056496 |
| Chromosome: | chromosome 13 |
| Location: | 622090 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g565750 | EFG4 | (1 of 1) K14416 - elongation factor 1 alpha-like protein (HBS1); Translation elongation factor Tu family protein | 5'UTR |
| Cre13.g565800 | UPTG1,UPT1,RGP1,UTPG1,EZY11 | UDP-Arabinosyl mutase. .; (1 of 1) 5.4.99.30 - UDP-arabinopyranose mutase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TATTTGTTGCACGCCGGGTGCGTCCGAACAATTCTACTGCTGGCACCAAA |
| Internal bar code: | GCAGTAGTGTTAGTCGACAGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1764 |
| LEAP-Seq percent confirming: | 96.0 |
| LEAP-Seq n confirming: | 24 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 25 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGAGGAGTGCTACATCGAGC |
| Suggested primer 2: | TGTGTGAAGACGTTGGGAGG |