| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.056522 |
| Chromosome: | mitogenome |
| Location: | 955 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreMt.g802337 | cob,801484,ChrepMp01 | (1 of 1) K00412 - ubiquinol-cytochrome c reductase cytochrome b subunit (CYTB, petB); cytochrome b | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAAGACTAGAATGCTGAACACAAGAGCCAAGAACAAAGCACCGACCAAGT |
| Internal bar code: | TGGCCGGCCATCTCGTTCAGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 129 |
| LEAP-Seq percent confirming: | 22.2222 |
| LEAP-Seq n confirming: | 2 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGGGCTTTCAACCGTGTTG |
| Suggested primer 2: | CTGTGGTGAAGTGTGCGTTG |