| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.056536 |
| Chromosome: | chromosome 3 |
| Location: | 5637406 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g186200 | CDS1,PCT1 | Phosphatidate cytidylyltransferase; (1 of 1) PTHR13773:SF8 - PHOSPHATIDATE CYTIDYLYLTRANSFERASE, PHOTORECEPTOR-SPECIFIC | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCAGTCAAAACAAGGAATGCATAGCTAAGTTTGCACTTAATGAGCCACG |
| Internal bar code: | GAATCACGTATTACATCGATCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2788 |
| LEAP-Seq percent confirming: | 95.7576 |
| LEAP-Seq n confirming: | 158 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 165 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCGCCATGGCTAACGACTAT |
| Suggested primer 2: | ATGTAGGCGATGCGGAAGAG |