Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.056551 |
Chromosome: | chromosome 17 |
Location: | 3729670 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g726250 | ATP12 | Assembly factor 2 for F1 mitochondrial ATP synthase; (1 of 1) K07556 - ATP synthase mitochondrial F1 complex assembly factor 2 (ATPeAF2, ATPAF2, ATP12) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCCCCGCTCTTCACTGGCATCATGGCACTGCTCCTGCGCAACATTGCCC |
Internal bar code: | GCGTGTCATGTAAGGGGGCCAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 4657 |
LEAP-Seq percent confirming: | 93.1818 |
LEAP-Seq n confirming: | 123 |
LEAP-Seq n nonconfirming: | 9 |
LEAP-Seq n unique pos: | 132 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CATAGATTTGGTGCAGGCGC |
Suggested primer 2: | GCAATAAGCAAGCAGGAGCC |