| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.056561 |
| Chromosome: | chromosome 1 |
| Location: | 2887800 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g017900 | (1 of 8) IPR011047//IPR018391 - Quinonprotein alcohol dehydrogenase-like superfamily // Pyrrolo-quinoline quinone beta-propeller repeat | 3'UTR | |
| Cre01.g017951 | (1 of 21) IPR001611//IPR003591 - Leucine-rich repeat // Leucine-rich repeat, typical subtype | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGAGACCGTAGTTGGTCCGTACAGACAGTCATTGAAGTGCGGATACCAA |
| Internal bar code: | ACTATCTTAATTGTATAGCCTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2627 |
| LEAP-Seq percent confirming: | 95.2381 |
| LEAP-Seq n confirming: | 40 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 42 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGAGGAAGCAGAGGAGGAG |
| Suggested primer 2: | TCGAAAAGAAGCGCCTTCCT |