| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.056603 |
| Chromosome: | chromosome 3 |
| Location: | 2878561 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g162366 | (1 of 2) 1.10.3.3 - L-ascorbate oxidase / Ascorbase | 3'UTR | |
| Cre03.g162400 | HEATR2B,HTR2B,DNAAF5 | (1 of 1) IPR011989//IPR016024//IPR021133 - Armadillo-like helical // Armadillo-type fold // HEAT, type 2; 5-Hydroxytryptamine Receptor 2B | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGGCGCACCTCGGGGTCCGAGATGGCCTGTGTGATTATGTGTGATTGTG |
| Internal bar code: | CCACTTTCTCTGAGTGCGTATT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 310 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACTCCTTGGCATTGGGGAT |
| Suggested primer 2: | GCCGAGGAGGAGATTGATGG |