| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.056623 |
| Chromosome: | chromosome 1 |
| Location: | 2049005 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g011300 | SCLP50,CPY | Serine carboxypeptidase; (1 of 3) K09645 - vitellogenic carboxypeptidase-like protein [EC:3.4.16.-] (CPVL) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATCCCTTGCGAATGTGTTTGCAACTTCGCAGCTTCATCACCAACGCCAC |
| Internal bar code: | TGGAAGGTGACCCCGATGACGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 373 |
| LEAP-Seq percent confirming: | 63.6364 |
| LEAP-Seq n confirming: | 14 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGCCACAACAACATGACAG |
| Suggested primer 2: | GCTGCAACTGTACCTGCCTA |