Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.056644 |
Chromosome: | chromosome 8 |
Location: | 1572026 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre08.g365450 | (1 of 17) IPR001305 - Heat shock protein DnaJ, cysteine-rich domain | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATATGACTACGTAGAGCCAGTGCTGTGATGTGCTACGACGCATGGGCTGG |
Internal bar code: | GAGGTTCCAAGTAGTGGGGTAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 901 |
LEAP-Seq percent confirming: | 4.85437 |
LEAP-Seq n confirming: | 5 |
LEAP-Seq n nonconfirming: | 98 |
LEAP-Seq n unique pos: | 103 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGGACCATCAGTGAAGCCAA |
Suggested primer 2: | TCACCATTAGGACGCACCAC |