| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.056658 |
| Chromosome: | chromosome 6 |
| Location: | 5089237 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g282600 | HEL27 | (1 of 1) K14809 - ATP-dependent RNA helicase DDX55/SPB4 [EC:3.6.4.13] (DDX55, SPB4); DEAD/DEAH box helicase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTGTTGAAGAAGCTGAAGAAGGGCAAGATCAGCCAGCACCAGTACAACG |
| Internal bar code: | TGAGTCAGGAGATACAACCCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 142 |
| LEAP-Seq percent confirming: | 50.0 |
| LEAP-Seq n confirming: | 3 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAAGGACCCTCGCAGTCGTA |
| Suggested primer 2: | ACTGTCTGCGGCATTCTCAA |