| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.056672 |
| Chromosome: | chromosome 12 |
| Location: | 8189703 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g551800 | (1 of 2) 3.6.1.17 - Bis(5'-nucleosyl)-tetraphosphatase (asymmetrical) / Dinucleosidetetraphosphatase (asymmetrical) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGAGTGTGGTAGGGTAGAGTGGAGGCAGTCTATTCCTGTGCTCATGGCAC |
| Internal bar code: | TATAAGTGCCTGCTGCCATTCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1582 |
| LEAP-Seq percent confirming: | 72.7273 |
| LEAP-Seq n confirming: | 16 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCAAGGAAGGCTGAGTGGAT |
| Suggested primer 2: | GACGATGACGACGATGACGA |