Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.056712 |
Chromosome: | plastome |
Location: | 89944 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
CreCp.g802300 | rps18,ChreCp036,2717007 | (1 of 2) PF01084 - Ribosomal protein S18 (Ribosomal_S18); 30S ribosomal protein S18 | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAACGACGATTATAAAGAGTTTTTTCAGGTTTTTCTTTAAGAACAATTAC |
Internal bar code: | ATAGATCGGGCATTGGTTGCTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 198 |
LEAP-Seq percent confirming: | 5.26316 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 18 |
LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACAAATTGCAGCCCCTCAGT |
Suggested primer 2: | GAAGGGGAAGGACGTCAGTG |