| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.056717 |
| Chromosome: | chromosome 17 |
| Location: | 1350180 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g705843 | Chlamydomonas-specific family W protein; (1 of 6) PF06701 - Mib_herc2 (MIB_HERC2) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGTTTCTGTGTGCTGCGTGTGGGTAGTGGGCGGCGGGGTGGTGCGCGGC |
| Internal bar code: | CTCTAAGCTCCAGTCAATAGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4436 |
| LEAP-Seq percent confirming: | 80.3571 |
| LEAP-Seq n confirming: | 45 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | 56 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCCTGCGCATATGCAAGGAA |
| Suggested primer 2: | GAGATAGAGGCGGTGCAGTC |