| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.056724 |
| Chromosome: | plastome |
| Location: | 159959 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreCp.g802323 | 2717034,atpB,ChreCp058 | (1 of 1) K02112 - F-type H+-transporting ATPase subunit beta (ATPF1B, atpD); ATPase beta chain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAACGGAAAATGTTATCAATGAAGAATAATACGTCTTGTTTGTTAACATC |
| Internal bar code: | TAGGTTGAGAAAGGACATTTGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 130 |
| LEAP-Seq percent confirming: | 8.0 |
| LEAP-Seq n confirming: | 2 |
| LEAP-Seq n nonconfirming: | 23 |
| LEAP-Seq n unique pos: | 25 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGGTCTTTTCGGTGGTGCT |
| Suggested primer 2: | ACTCGCACGTTTCCTTTAGT |