| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.056735 |
| Chromosome: | chromosome 1 |
| Location: | 5366237 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g037900 | (1 of 2) K03257 - translation initiation factor 4A (EIF4A) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGATAGGATGGCGGTGGGCAGGGCGGTGGGATGTTGCATGGCAGGATGGG |
| Internal bar code: | TCGAATCTTTAAGCTATACTTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1219 |
| LEAP-Seq percent confirming: | 51.4286 |
| LEAP-Seq n confirming: | 18 |
| LEAP-Seq n nonconfirming: | 17 |
| LEAP-Seq n unique pos: | 35 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATACGCCCCAAAACCTCCTG |
| Suggested primer 2: | CAAGGACCTACTGCCAGTGG |