| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.056742 |
| Chromosome: | plastome |
| Location: | 187373 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreCp.g802331 | 2716963,ChreCp066,psbC | (1 of 1) K02705 - photosystem II CP43 chlorophyll apoprotein (psbC); photosystem II 43 kDa protein | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGTTACTTGTTTGGAAAGCTATGTACTTTGGTGGTGTTTACGATACTTG |
| Internal bar code: | AGAGACGAGATTCACGAGTAGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 765 |
| LEAP-Seq percent confirming: | 88.2353 |
| LEAP-Seq n confirming: | 15 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTTTCGAAACCAGCAGCAGC |
| Suggested primer 2: | GGCCGTGACCAAGAAACAAC |