| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.056743 |
| Chromosome: | plastome |
| Location: | 10723 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreCp.g802266 | 2716978,psbK,ChreCp004 | (1 of 1) K02712 - photosystem II PsbK protein (psbK); photosystem II K protein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGAAGGATATTAACAGGCTAAAAAATTAACGGAAACTAACAGCTGCTTGC |
| Internal bar code: | GACGTATTACTTGTTCTTGATG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 400 |
| LEAP-Seq percent confirming: | 40.0 |
| LEAP-Seq n confirming: | 24 |
| LEAP-Seq n nonconfirming: | 36 |
| LEAP-Seq n unique pos: | 60 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATAGGGTCGCAGGTTCGAA |
| Suggested primer 2: | ACCAACTGAACCACCAGCTG |