| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.056782 |
| Chromosome: | chromosome 10 |
| Location: | 1721028 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g430050 | UBC20 | E2 Ubiquitin conjugating enzyme; (1 of 1) K10583 - ubiquitin-conjugating enzyme E2 S (UBE2S, E2EPF) | 3'UTR |
| Cre10.g430100 | ELG22 | Exostosin-like glycosyltransferase 22; (1 of 6) IPR000742//IPR004263//IPR009030 - EGF-like domain // Exostosin-like // Insulin-like growth factor binding protein, N-terminal | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACGCGCCCAGGATTGCTCTGATGACCGGGTAGCGTGGCCCCGTTACCTG |
| Internal bar code: | CTCCTTCATGGTAGGGATTCCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4144 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 35 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 35 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTTGCATGAGAGCTGACGT |
| Suggested primer 2: | GGATCAAACGCCGTATTGCC |