Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.056784 |
Chromosome: | chromosome 16 |
Location: | 7823614 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g688526 | (1 of 1) PF00069//PF01846 - Protein kinase domain (Pkinase) // FF domain (FF) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGTCAGGAACACATTTACAGTACTTACTCTGCAACACGGGGCGAAGATG |
Internal bar code: | TGGTATACCGGTTTTCACGTTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2044 |
LEAP-Seq percent confirming: | 35.0515 |
LEAP-Seq n confirming: | 34 |
LEAP-Seq n nonconfirming: | 63 |
LEAP-Seq n unique pos: | 97 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AAGTGTTGCTCGTTTGCGTC |
Suggested primer 2: | CGTCAATTTCGAGCGAGCAG |