| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.056787 |
| Chromosome: | chromosome 11 |
| Location: | 3874800 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g479600 | MHX1,CAX6 | (1 of 1) K05849 - solute carrier family 8 (sodium/calcium exchanger) (SLC8A, NCX); putative Ca2+/Na+ exchanger | 5'UTR |
| Cre11.g479650 | CHIP,CHIP1 | (1 of 1) K09561 - STIP1 homology and U-box containing protein 1 (STUB1, CHIP); Carboxyl terminus of Hsc70-interacting protein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGACTTTCCACCGTGCCTGAACCGACGTCACTCGTCTTTCCGCGTCTCT |
| Internal bar code: | GTGCCAGTAACATTGTGGCAAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1690 |
| LEAP-Seq percent confirming: | 98.1481 |
| LEAP-Seq n confirming: | 53 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 54 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGGCAGCATGTTGAATCCT |
| Suggested primer 2: | CGCAATGACTTGATCGCAGG |