Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | + |
Strain: | CLIP2.056806 |
Chromosome: | chromosome 2 |
Location: | 3921301 |
Confidence (%): | 40 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g101950 | TRM2B,TMU2 | tRNA (uracil-5)-methyltransferase; (1 of 1) K15332 - tRNA (uracil-5-)-methyltransferase [EC:2.1.1.-] (TRMT2A) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCACAGGGCATCCCAGGCAACGCCTAGAAGCACGACCAGGCCCGACGCC |
Internal bar code: | ACCGGACGCCCGGCCAAGATAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 638 |
LEAP-Seq percent confirming: | 43.4783 |
LEAP-Seq n confirming: | 10 |
LEAP-Seq n nonconfirming: | 13 |
LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACCTCCTCACCCCTACATCC |
Suggested primer 2: | GGGGGTTTGCAGGTGTAAGT |