| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.056826 |
| Chromosome: | chromosome 3 |
| Location: | 505803 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g145087 | MTP1 | Metal Transport Protein 1; (1 of 1) K14689 - solute carrier family 30 (zinc transporter), member 2 (SLC30A2, ZNT2) | 3'UTR |
| Cre03.g145107 | (1 of 3) K10406 - kinesin family member C2/C3 (KIFC2_3) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGTGAGGTTCCGCGTGAGGTCCCACGTTAGATTGCAAGGGAACCCATAGC |
| Internal bar code: | ATCAAATTACAGGCGTTATATT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1801 |
| LEAP-Seq percent confirming: | 56.7568 |
| LEAP-Seq n confirming: | 21 |
| LEAP-Seq n nonconfirming: | 16 |
| LEAP-Seq n unique pos: | 37 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACGTGATGCTACCGACGAT |
| Suggested primer 2: | ATACCAGTTCCTGCCTTGGC |