| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.056840 |
| Chromosome: | chromosome 16 |
| Location: | 2440607 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g660050 | CMT1B | (1 of 2) PTHR12608//PTHR12608:SF7 - TRANSMEMBRANE PROTEIN HTP-1 RELATED // GDT1-LIKE PROTEIN 2, CHLOROPLASTIC; Mn and/or Ca transport | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCGTCGCCTTCCCCTGCCGTCCGCGCAGTATCCCACCAGCCTCGCTAAC |
| Internal bar code: | CATAGGGTATCCCTTGCCAGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 619 |
| LEAP-Seq percent confirming: | 50.0 |
| LEAP-Seq n confirming: | 6 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTGTTAGTGATGCTGGGCT |
| Suggested primer 2: | CATGGGTGAACAGTGCTTGC |