| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.056842 |
| Chromosome: | chromosome 7 |
| Location: | 4965730 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g347000 | (1 of 6) IPR001245//IPR011009 - Serine-threonine/tyrosine-protein kinase catalytic domain // Protein kinase-like domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGAAATGAGTCGCACCCCCTGCCTACTCCCGCGCCTTCCCGCCCGGCCC |
| Internal bar code: | GGTTTTCGGCCGATCTGCTGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 237 |
| LEAP-Seq percent confirming: | 33.3333 |
| LEAP-Seq n confirming: | 11 |
| LEAP-Seq n nonconfirming: | 22 |
| LEAP-Seq n unique pos: | 33 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGCACATATGGTTGCTCTG |
| Suggested primer 2: | GTACGCACACCCAGACTCAA |