| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.056857 |
| Chromosome: | chromosome 13 |
| Location: | 955096 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g568150 | CMAL1,SMM45,CMAL | S-adenosyl-L-methionine-dependent methyltransferase; (1 of 1) 2.1.1.199 - 16S rRNA (cytosine(1402)-N(4))-methyltransferase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAATGCCGTACAGCTGCCCCGCCCCGCGAGCTTTCGCGGGCAGGTGTGAA |
| Internal bar code: | TCATAGGCGCAGCTATTTTTTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 823 |
| LEAP-Seq percent confirming: | 94.1176 |
| LEAP-Seq n confirming: | 48 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 51 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTCGCTTTTCTGGACGAGCT |
| Suggested primer 2: | GGGTCCCAAATGTTTGTGCC |