| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.056997 |
| Chromosome: | chromosome 3 |
| Location: | 3129498 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g164650 | MOT56,MOT1 | Putative methyltransferase in motile organisms; (1 of 3) K05302 - SET domain-containing protein 6 (SETD6) | outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCATCCTTATAACGCCGGGAAACTTAATTTGCGCAACGAAGTTAGGCGT |
| Internal bar code: | GCAGGGACTGGGGACCTCTATT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1894 |
| LEAP-Seq percent confirming: | 91.3043 |
| LEAP-Seq n confirming: | 21 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGCGTCTCTAGCACTTCGAT |
| Suggested primer 2: | CGCACCCCACTTTCTTGTTG |