| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.057061 |
| Chromosome: | chromosome 6 |
| Location: | 5027671 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g281900 | CrZIP7,ZIP7,ZIL2 | (1 of 1) PTHR11040//PTHR11040:SF68 - ZINC/IRON TRANSPORTER // SUBFAMILY NOT NAMED; Zinc/iron transporter | gene_edge/mRNA_edge/3'UTR |
| Cre06.g281950 | (1 of 16) PF07707 - BTB And C-terminal Kelch (BACK) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGACCATGGAGTACTGAAACGTTCTTTAAAGGCGAGAGTTTCCACCTCT |
| Internal bar code: | AGTTCGCTGGAGTAAGTCTAGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1493 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 15 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACTGGTACGGCATGGAAGG |
| Suggested primer 2: | TGGGTTGGTAGTTGTGGACG |