| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.057081 |
| Chromosome: | chromosome 11 |
| Location: | 2690374 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g095072 | FAP144 | (1 of 1) PF14886 - FAM183A and FAM183B related (FAM183); Flagellar Associated Protein 144 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCAGGGCTTGGGTGGTGTGGGAGGCGGGTGGTGGACTGGGCCGTACGACC |
| Internal bar code: | GTACTTTTGACATCCTCGTAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 183 |
| LEAP-Seq percent confirming: | 14.2857 |
| LEAP-Seq n confirming: | 7 |
| LEAP-Seq n nonconfirming: | 42 |
| LEAP-Seq n unique pos: | 49 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACCCACCTCCTACACACAC |
| Suggested primer 2: | TGGATGATGTAGGCAGGGGA |