| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.057089 |
| Chromosome: | chromosome 10 |
| Location: | 1015736 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g801111 | (1 of 7) PF00628//PF00665 - PHD-finger (PHD) // Integrase core domain (rve) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGGACTCGAAGCCAGCAATGAGGATTGACTAACCCAGTGACGTGAGACT |
| Internal bar code: | AAGCTGTCCTTACCTCTCCCGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1523 |
| LEAP-Seq percent confirming: | 81.9672 |
| LEAP-Seq n confirming: | 50 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | 61 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGTCACACGCACTGAGTCA |
| Suggested primer 2: | TCAGTTGTACGGGCAGTTCC |