| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.057094 |
| Chromosome: | chromosome 12 |
| Location: | 5511347 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g530250 | 3'UTR | ||
| Cre12.g530300 | FKB16C,FKB6,FKB16-3 | (1 of 1) PTHR10516//PTHR10516:SF264 - PEPTIDYL-PROLYL CIS-TRANS ISOMERASE // FK506-BINDING PROTEIN 1; peptidyl-prolyl cis-trans isomerase, FKBP-type | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAACAACCCGTTCTTGCCGATTCTACCTTTCAACAACGCAAGATTGCGT |
| Internal bar code: | ACTCAATTACCCTAGGTGTACC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 5028 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 32 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 32 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTTCCACCTGTACGACACC |
| Suggested primer 2: | GAGGCGGGAGGTTGAGAAAA |