| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.057104 |
| Chromosome: | chromosome 3 |
| Location: | 675490 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g145767 | RRP6,RRP6a | putative exosome subunit; (1 of 1) K12951 - cation-transporting P-type ATPase D (ctpD) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TATGATATCATAATGAAGCATAGACAGCGTTTCTGCTCCTCCTGGCAACA |
| Internal bar code: | TCTTGTTGACGAATTTTGCAAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 830 |
| LEAP-Seq percent confirming: | 18.1818 |
| LEAP-Seq n confirming: | 8 |
| LEAP-Seq n nonconfirming: | 36 |
| LEAP-Seq n unique pos: | 44 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATCTCCGCAATGTCGTCCTC |
| Suggested primer 2: | TACACCACTTGGAAGCCGTC |